Stock No: 007668
Protocol 22021: Probe Assay - Arntl<tm1Weit> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  130 bp

Wild Type = 149 bp

>chr7:120429483+120429631 149bp ACAGAAACATTGACTCTCATGCT CACACCCAGCTTAAGGCACA

Sequence

Wt Sequence: tgagagaggcatccctctgtgtctgtataaggtcactagaaagaagttgcttttgttctgacttttgatcactattgagcaatacagaaacattgactctcatgcttgaagagtgatactgaaaatgggattttagtactgaagagatgggttataATtaatta

attgttagcaagttggtcagaaaatttcaagggatgtagattaagacatgtgccttaagctgggtgtggtggcacacgcctttaatcccagcacacaggagg

 

Mutant Sequence: GGTGAGAGAGGCATCCCTCTGTGTCTGTATAAGGTCACTAGAAAGAAGTTGCTTTTGTTCTGACTTTTGATCACTATTGAGCAATACAGAAACATTGACTCTCATGCTTGAAGAGTGATA

CTGAAAATGGGATTTTAGTACTGAAGAGATGGGTTATAAgaattccgaagttcctattctctagaaagtataggaacttcatcagtcaggtacataatataacttcgtataatgtatgctatacgaagttattaggtggatccttaattaatt

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
33524 ACA GAA ACA TTG ACT CTC ATG CT Common A
33525 ATG TAC CTG ACT GAT GAA GTT CC Mutant Reverse A
33526 CAC ACC CAG CTT AAG GCA CA Wild type Reverse A
33527 Fluorophore-1 AGA ATT CCG AAG TTC CTA TTC TCT AGA Quencher-1 MUT Probe
33528 Fluorophore-2 TGG TCA GAA AAT TTC AAG GGA T Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
33524 0.40 uM
33525 0.40 uM
33526 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.