For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 002378
Protocol 19966: End Point Analysis Assay - Dmd<mdx-4Cv> EP Alternate1
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant =T/T
Heterozygote = C/T
Wild type = C/C
Sequence
tacatgtgcaatgacgtttagattctaaatttccactgtcttctcttgagtaataattactg
ttctttattcttatttttattccagTTGAAAGAATTCAGATTCAGTGGGATGAGGTTCAAGA
ACAGCTGCAGAACAGGAGA(c/t)AACAGTTGAATGAAATGTTAAAGGATTCAACACAATGGC
TGGAAGCTAAGGAAGAAGCCGAACAGGTCATAGGACAGGTCAGAGGCAAGCTTGACTCATG
GAAAGAAGGTCCTCACACAGTAGATGCAATCCAAAAGAAGATCACAGAAA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 29091 | Fluorophore-1 | AGA ACA GGA GAC AAC AGT TGA ATG A | Quencher-1 | WT Probe | ||
| 29092 | Fluorophore-2 | CTG CAG AAC AGG AGA TAA CAG T | Quencher-2 | MUT Probe | ||
| 29573 | TCA GAT TCA GTG GGA TGA GG | Forward | A | |||
| 29574 | TCC TTA GCT TCC AGC CAT TG | Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 29573 | 0.40 uM |
| 29574 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.