Stock No: 002019
Protocol 21960: End Point Analysis Assay - Foxn1<nu>
Version 4.0

Notes

TGS Design, KC 12/20/11.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

MUT = GG

WT = GGG

amplicon = 128 bp

Sequence

Foxn1 genomic

 

CTTCCGCCTTTCTCCTTCAGAAAAGTATCCTGGCTTTGGCTTTGAGGAGGGC
CCAGCAGGCAGCCCA(ggg)CGCTTCCTCAAGGGCAACCACATGCCTTTCCACC
CCTACAAGAGGCACTTCCATGAGG
 
Mutant has 2 G's in indicated location, Wild type has 3 G's.

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
13775 CTT CCG CCT TTC TCC TTC AG Forward A
13776 CCT CAT GGA AGT GCC TCT TG Reverse A
13777 Fluorophore-1 CAG CCC AGG CGC TTC Quencher-1 MUT Probe
13778 Fluorophore-2 CAG CCC AGG GCG CTT C Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
13775 0.40 uM
13776 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
000819 B6.Cg-Foxn1nu/J
000711 CByJ.Cg-Foxn1nu/J
007850 J:NU
002019 NU/J
003118 STOCK Ces1ce Foxn1nu/J
5 strains use this protocol