C57BL/6J-Hexa^{em2(HEXA*)Rlp}/J

Stock number: 040822
Product name: HEXA c.805A
Research areas: Metabolism Research, Mouse/Human Gene Homologs, Neurobiology Research

Description

HEXA c.805A knock-in mice have exon 7 of the endogenous Hexa gene replaced with a mutant human exon 7 (c.805A) found in patients with Late-onset Tay-Sachs (LOTS) disease. These mice are useful for studying a common LOTS mutation.

Detailed description

HEXA c.805A knock-in mice have exon 7 of the endogenous hexosaminidase A (Hexa) gene replaced with a mutant human exon 7 (c.805A) found in patients with Late-onset Tay-Sachs (LOTS) disease. Hexa encodes a preproprotein that is proteolytically processed to generate the alpha subunit of the lysosomal enzyme beta-hexosaminidase A.

LOTS disease is a lysosomal storage disorder most commonly caused by a point mutation (c.805G>A) in the HEXA gene. Deficiency of beta-hexosaminidase A results in the lysosomal accumulation of its substrate, GM2 ganglioside, a glycosphingolipid found in the cell membranes of neurons. This accumulation can build up to toxic levels in the brain and spinal cord and progressively destroys neurons. Null mutations in HEXA result in the complete loss of enzymatic activity and lead to an acute infantile-onset neurodegenerative disease. Signs and symptoms start to show up at 3 to 6 months of age. As the disease progresses, development slows, and muscles begin to weaken. Over time, this leads to seizures, vision and hearing loss, paralysis, and other major issues. Children with an infantile-onset form of Tay-Sachs disease typically live only a few years. Unlike the more severe infantile-onset and juvenile-onset forms of Tay-Sachs disease, LOTS typically does not impact life expectancy and progresses much more slowly.

The c.805G>A mutant mice are relatively unaffected. They exhibit lower levels of α-subunit β-hexosaminidase enzyme activity and live over 1 year of age. When bred to neuraminidase 3 (Neu3) KO mice (Stock No. 041010) the mice show severe features of Tay-Sachs disease including neurodegeneration, GM2 ganglioside accumulation, and shortened life span (4-5 months). Deletion of NEU3 disables a bypass pathway which also processes GM2 ganglioside.

Homozygous mice are viable and fertile.

Of note, HEXA c.805G knock-in/knock-out mice (Stock No. 040823) contain a wildtype human exon 7 (c.805G) and serve as a control strain for this HEXA c.805A strain.

Development

sgRNAs (GACGAGTGTTCTAAAATTCA and CTAGAGGGAGTTCCTTCCAT) were designed target intron sequences flanking exon 7 of the endogenous hexosaminidase A (Hexa) gene. A donor ssDNA template containing a mutant human HEXA exon 7 was designed to create a guanine (G) to adenine (A) mutation (c.805A) in the human exon 7 sequence, which results in a glycine to serine amino-acid change at position 269 (G269S), a common point mutation found in patients with Late-onset Tay-Sachs (LOTS) disease. sgRNA, the cas9 protein, and the mutant ssDNA template were introduced into C57BL/6J-derived embryos with well-recognized pronuclei. Injected embryos were transferred to pseudopregnant females. Resulting HEXA c.805A mutant knock-in/knock-out mice were identified by PCR and sequencing, and correctly targeted offspring were further bred to C57BL/6J mice (Stock No. 000664) for at least 1 generation by the donating laboratory to remove any off-target CRISPR sites. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Hexa^{em2(HEXA*)Rlp}
Name: endonuclease-mediated mutation 2, Richard Proia
MGI accession ID: MGI:8243294
Generation method: Endonuclease-mediated
Attributes: Inserted expressed sequence; Humanized sequence
Synonyms: HEXA c.805A
Marker symbol: Hexa
Marker name: hexosaminidase A
Marker synonyms: Hex-1; TSD
Chromosome: 9
Strain of origin: C57BL/6J
Molecular note: sgRNAs (GACGAGTGTTCTAAAATTCA and CTAGAGGGAGTTCCTTCCAT) were designed to target intron sequences flanking exon 7 of the endogenous hexosaminidase A (Hexa) gene. A donor ssDNA template containing a mutant human HEXA exon 7 was designed to create a guanine (G) to adenine (A) mutation (c.805A) in the human exon 7 sequence, which results in a glycine to serine amino-acid change at position 269 (G269S), a common point mutation found in patients with Late-onset Tay-Sachs (LOTS) disease.