Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 86 bp
Wild Type = 119 bp
>chrX:104498118+104498236 119bp CAACAAGCAATCTGGCATTT AGACTCTCCTGCTATCATGT
X-Linked
Deletion in lower case:
TGATTTTGTTACTACCAATGGTGTTTTGTTTACCATAACTCAAGTTGAAGTTATGTGCCTTTCATACTCTTGACTGAATCAGAAGGCACACTGGTGCCATTTGGTGTCAGTCACGTGTCAGATGGAGGTTGGATACTTAGCAACAAGCAATCTGGCATTTAGATCTGTCCCTGCAGTTAATACATGGtgggggacccacttcctacctccctaacctaagccctgagatcttgagtctaacatgatagcaggagagtctctgcaagctctgaacttcttctttctttgaccttctagatcagacttgttgtagaagagggactgaatcagctgccatataaagaatgtatggtgaccactccgacaggtaaccagggcttgtactcgcaaattttcctcataaaaattctgagctagactggggttagaGGAGGGAAATGGAAGGAAGACATCCTCTGTAAAATCAGTGTGAAAAATCAGGAGTTTATGTATGACTGGGTTTTTTTTTTAACATCTTTAAAAACTAAGAGAGTTTTTGTTAAGAAATCTACATAGGTGACTTTTTGTTAATGGCTTGCTTGTCAATTCAAGTTAAAGGTTATTACATACTCTTCAGCATGCAGGTGTTGCTTCTGATGGC
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CTGCAGTTAATACATGGTGG and GCTAGACTGGGGTTAGAGGA. This resulted in a 242 bp deletion of ChrX:104,498,165-104,498,406 (GRCm38/mm10) that removes exon ENSMUSE00000208388.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
72993 | AGA CTC TCC TGC TAT CAT GT | Wild type Reverse | A | |||
72994 | Fluorophore-1 | CCT AAC CTA AGC CCT GAG AT | Quencher-1 | WT Probe | ||
74069 | CAA CAA GCA ATC TGG CAT TT | Common | A | |||
74070 | ACT GAT TTT ACA GAG GAT GTC T | Mutant Reverse | A | |||
74071 | Fluorophore-2 | TCC TTC CAT TTC CCT CCC CA | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
72993 | 0.40 uM |
74069 | 0.40 uM |
74070 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.