Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 70 bp
Wild Type = 133 bp
>chr6:40443919-40444051 133bp CTCTCAGTGTCTTCTTCACA TCCTTACCTCTGTAGATTTATAGTG
Large deletion: Mutant sequence with junction in uppercase
ttgagatctttgtacattcaagctggttcagttttgtatcctgtaagagttttcaaaaggctgtgttgtgtagcaaaaggccagaagtgagttcctaCAaggaggtctcggagtggaaaacactataaatctacagaggtaaggagaagaaaaaaaaaaaaaacccaacctgttgcacaacgtctgcttgccctcccctctacccaccaacagctgtgagac
This mutation is a 21,994 bp deletion of Chr6:40,443,966-40,465,959 (GRCm38/mm10)
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
70231 | CTC TCA GTG TCT TCT TCA CA | Wild type Forward | A | |||
70232 | TCC TTA CCT CTG TAG ATT TAT AGT G | Common | A | |||
70233 | AAA GGC CAG AAG TGA G | Mutant Forward | A | |||
70234 | Fluorophore-1 | ATT TCT TGT TCA GTC CCT GG | Quencher-1 | WT Probe | ||
70235 | Fluorophore-2 | TTC CTA CAA GGA GGT CTC GG | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
70231 | 0.40 uM |
70232 | 0.40 uM |
70233 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.