For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 039029
Protocol 47271: Probe Assay - Tmeff1<em1(IMPC)J>-Alt1
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 77bp
Wild Type =126bp
>chr4:48604643+48604768 126bp GTCTGCAAAGAAGATGGAGA ACTACGTGCATTTTATTTGAGA
Sequence
Wt Sequence (deletion in lower case):
GAGAGCCTCCTGTCTGGGATTACAGGTGTAGTCAGATGCCTGGCTTATTGTGTCGGTGCTGGGATGTGAACTCTGGTCCTCATGTTTGTATAACAGGTGCTCTTCACTTTGGAGCCATCTCTCTGGCACCATAACTTTATTATATTGTCTGTTATTATACCAgtgaatgagatgcctagtacatttgtgcttttattaatctgtgtacgttgtggtgtgtgtgtgtgtgtgtgtttgtatatgtgtgtgtgtgtgtatgtataagtgtgtgtagtatatgtgtatggctgtgtatacacatgaaacaatgttttcttctcttgcagaattaaatctgagagaatctgacatcagagtgtgtgatgaatcatcttgtaaatatggaggtgtctgcaaagaagatggagatggtttgaaatgcgcatgccagtttcaggtgagaaaaccaaaattaacttaattttaccctcccccgttttGTAATCTGACATTTCTCAAATAAAATGCACGTAGTACCTTGAGCCCCGAAGGAATTTAGCACCCAGCCCACTGATTCTTTCTTGGCAGGTGAAGTCCTGTTATTTGTGTTTTCTGTGGTTCATTTCAGAAATTAAAGAGGACAGACTGACCGTGATAGGTGTGCACATGCG
This mutation is a 317 bp deletion beginning at Chromosome 4 position 48,604,417 bp and ending after 48,604,733 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 69095 | GTC TGC AAA GAA GAT GGA GA | Wild type Forward | A | |||
| 69096 | ACT ACG TGC ATT TTA TTT GAG A | Common | A | |||
| 69097 | CTC TGG CAC CAT AAC TTT ATT ATA | Mutant Forward | A | |||
| 69098 | Fluorophore-1 | AGG TGA GAA AAC CAA AAT TA | Quencher-1 | WT Probe | ||
| 70174 | Fluorophore-2 | TCT GTT ATT ATA CCA GTA ATC TGA CA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 69095 | 0.40 uM |
| 69096 | 0.40 uM |
| 69097 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.