For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 039012
Protocol 46827: Probe Assay - Ankdd1a<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 80 bp
Wild Type = 103 bp
>chr9:65503295-65503397 103bp TCATGTCTGTGCCATTGAG CAGAACACAGAACTCACCTC
Sequence
Wt Sequence (deletion in lower case):
CTGGCTGGAGGCTTCCTGGAGGAGGTGGCACAGTAGAGCTCTTTTGACTGTGGCAATGGGTTGAAAGTCAGGGAGGTGAGTTCTAGATGGAGGTCCAGTGGTCAAGGCAAGGCACAGTCAGACAGGGTGGCAGACATGAAGTCACAGACCCATGCTGATTCAGGTTCCCAGgttctgtatcacttgtatcacgagaaagaacttgcaaggaggccccagacggctcctgcacttttggaatctgaccccccacccccaggaccacctttcatgcagggatggcagcgacgtctctaggaagaacttaacctttaagcaagaccatcgtcaggaaacgcagcagctccgctccgtgctttggcgactggcctcccggtatctaaggcccaatgagtggaagaaactggcctattcctggcagttcacggaggctcatgtctgtgccattgagcaacagtggacaggtaccgcactaacctgccctaccccagGGCAGCCCGTGGATAGGGGCATGTGAGGTGAGTTCTGTGTTCTGTGCAGCTGGGGAAAGAAGCTTGCACAACCCGCAGCCCAGCTCCACTCTACTTCCAAAGCTCTCGTGGCTTCTTGCACAGGCTCTGCATCCCCATTCTACCTCCTTATGACCCTGA
This mutation is a 320 bp deletion beginning at Chromosome 9 position 65,503,339 bp and ending after 65,503,658 bp (GRCm38/mm10)
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 68951 | TCA TGT CTG TGC CAT TGA G | Wild type Forward | A | |||
| 68952 | CAG AAC ACA GAA CTC ACC TC | Common | A | |||
| 68953 | ATG AAG TCA CAG ACC CAT G | Mutant Forward | A | |||
| 68954 | Fluorophore-1 | GGA CAG GTA CCG CAC TAA | Quencher-1 | WT Probe | ||
| 68955 | Fluorophore-2 | GAT TCA GGT TCC CAG GGC AG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 68951 | 0.40 uM |
| 68952 | 0.40 uM |
| 68953 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.