Protocol 45976: Probe Assay - Art5<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  113 bp

Wild Type = 110 bp

chr7:102098070+102098179 110bp GTGAAGACTGCCCACACCTC TCAAGGCCCTGCATTTCTAC

 

Sequence

Wt Sequence (deletions in lower case):

CACAAACCCATGGCTGTCCGACTCCATTGCCTGTGTTATTTGTGTCTGTTTCGGATCCTGCCAATTgcatgcatcagctatgtcgcacagaaatgaaaacctgtccccagcagtccctggccagtgttttaaacttacactttggcctctgtggcacctcccttgtgtccataggttcgagctgttcctatcctgcccctgagcctggttccagatacctttgatgatgcctatgtgggctgctctgaggagatggaggagaaagcaggcctgctgctaaaggaagagatggcacgccatgccctgctgcgggaatcctgggaagcagcacaagaggcctgggcacaccggcgtcacaagctcactctacctcctggcttcaaagcccagcacggagtagcgattatggtgtacaccaactcatccaacaccttgtactgggagctgaaccaggccgtacggacaggaggtggctcccgggagctctacatgaggcacttccccttcaaggccctgcatttctacttgacccgggctctgcagctgctgcggggctctggagggtgcagtaggggacctggggaggtggtgttccgaggtgtgggcagtcttcactttgaacccaagaggctgggggactctgtccgattaggacagtttacctccagctctgtggatgagagagtggctcgcaggtttgggaatgccaccttcttcaatctaaggacttgttttggggctcctatccaggcgttgtctgtcttccctgaggagcgtgaggtgctgatacccccacacgaagtcttcttggtcactgggttctcccaggatggagcccagagcatagtgactctctggagttatgatcagacctgcagccactttaactgcgcctatttgggtggtgagcgatgaatgggagacagagaatggcagggtgggtgaaagaagccagtgtattctgacccagtccccagagccttcaggaaccacttggttagtgagattggggctccaccaggtcctgggagagttcaagatctgtggacatcctcagatgactgtcttctcaaaaggtcctctgtagtacctcgtAGACCAAGGAACAGCGAGAAGGAGGCAATATTGCTTCCGGTCTCAGTAGGCTCTGACTTGATGGGGCTA

This mutation is a 1029 bp deletion beginning at Chromosome 7 position 102,097,590 bp and ending after 102,098,618 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
66920 TCA AGG CCC TGC ATT TCT AC Wild type Reverse A
66921 GTG AAG ACT GCC CAC ACC TC Wild type Forward A
66922 CGA CTC CAT TGC CTG TGT TA Mutant Reverse A
66923 CCC ATC AAG TCA GAG CCT AC Mutant Forward A
66924 Fluorophore-1 CAG CGA GAA GGA GGC AAT ATT GC Quencher-1 MUT Probe
66925 Fluorophore-2 TAC TGC ACC CTC CAG AGC C Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
66920 0.40 uM
66921 0.40 uM
66922 0.40 uM
66923 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.