For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
chrX:56596142-56596270 129bp AATTGTGGCAGCAGATAGCAT AAATGGGAACGTGAAAGGTG
Mutant= 126 bp
Wild Type = 129 bp
Fam = Mut
Hex = Wt
X-LINKED
Large deletion: Mutant sequence with junction in uppercase
taccaggctttcgagttctacgcccacagccatttagcaacgccaccagccccaccttcttctcctcccaggcctttccgtaagtcccgccccttctccaaatccggcgcgtatttgcggacgctctacctcgTCtagtatgatgctgatttttaaatgtgtactgtaaatgatctgtaaaatcttcctttattttttgtttttaacattataatacaattatatagtttctccttttcctctactccctctaatgacttacatgtaccctccttgccatatttcaaattcatggcctctttttc
This mutation is a 12794 bp deletion beginning at Chromosome X position 56,585,378 bp and ending after 56,598,171 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
66551 | Fluorophore-1 | CGG ACG CTC TAC CTC GTC TAG TAT GA | Quencher-1 | MUT Probe | ||
66552 | Fluorophore-2 | ATC TCT GCC ATA GTG ACC TTT GAT | Quencher-2 | WT Probe | ||
66553 | AAT TGT GGC AGC AGA TAG CAT | Wild type Forward | A | |||
66554 | AAA TGG GAA CGT GAA AGG TG | Wild type Reverse | A | |||
66555 | CCT CCC AGG CCT TTC CGT A | Mutant Forward | A | |||
66556 | AGG AAG ATT TTA CAG ATC ATT TAC AG | Mutant Reverse | A |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
66553 | 0.40 uM |
66554 | 0.40 uM |
66555 | 0.40 uM |
66556 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |