For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr2:30274680+30274767 88bp TTTCTTGGTCCCTCCTGAGA CGGCTACTCTGCTTGCTTTT
Mutant= 80 bp
Wild Type = 88 bp
Wt Sequence: TTTCTTGGTCCCTCCTGAGAAATCTATCAACAAAATTGGCCATGgtaagcaggggcctgggagTgcagaaaagcaagcagagtagccg
Mut Sequence: ggtggcttacaaccatctgtaaatggatctgatgccctcttctgctgTGCCCCCTTgcagaaaagcaagcagagtagccg
A 592 bp deletion beginning at Chromosome 2 position 30,274,151 bp and ending after 30,274,742 bp (GRCm38/mm10). There is a 7 bp insertion (GCCCCCT)at the deletion site.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
66280 | GGT GGC TTA CAA CCA TCT GT | Mutant Forward | A | |||
66281 | CGG CTA CTC TGC TTG CTT TT | Common | A | |||
66282 | TTT CTT GGT CCC TCC TGA GA | Wild type Forward | A | |||
66283 | Fluorophore-1 | ATT GGC CAT GGT AAG CAG G | Quencher-1 | WT Probe | ||
67763 | Fluorophore-2 | TCT TCT GCT GTG CCC CCT | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
ddH2O | |
Kapa 2G HS buffer | 1.30 X |
MgCl2 | 2.60 mM |
dNTP KAPA | 0.26 mM |
66280 | 0.50 uM |
66281 | 0.50 uM |
66282 | 0.50 uM |
Glycerol | 6.50 % |
Dye | 1.00 X |
Kapa 2G HS taq polym | 0.03 U/ul |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |