For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr9:49470370-49470462 93bp TAACGGCAGCGAAAAATAAG GCACAGAGTCAGCCCTCAGT
Mutant= 87 bp
Wild Type = 93 bp
Wt Sequence: taacggcagcgaaaaataagcagcgctgggccaaactaGaaaaccggcgatctagaaggaccttccgacgtacactgagggctgactctgtgc
Mut Sequence:taacggcagcgaaaaataagcagcgctgggccaaactaGAGTGATggcaaatgtttaccaacaggctgcaagtgccagtttccatgg
A 321 bp deletion beginning at Chromosome 9 position 49,470,103 bp and ending after 49,470,423 bp (GRCm38/mm10). There is a 5 bp insertion ( AGTGA ) at the deletion site.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
66144 | TAA CGG CAG CGA AAA ATA AG | Common | A | |||
66145 | GCA CAG AGT CAG CCC TCA GT | Wild type Reverse | A | |||
66146 | CCA TGG AAA CTG GCA CTT G | Mutant Reverse | A | |||
66147 | Fluorophore-1 | CCG GCG ATC TAG AAG GAC C | Quencher-1 | WT Probe | ||
67120 | Fluorophore-2 | ACT AGA GTG ATG GCA AAT GTT TAC CA | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
66144 | 0.40 uM |
66145 | 0.40 uM |
66146 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |