Protocol 45619: Probe Assay - Ranbp3l<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  125 bp

Wild Type = 110 bp

  
>chr15:9007298+9007407 110bp TCTAAGACCCGCTGTTCTGC GCTCGGCCTTTTCCTTAGTT

Sequence

Wt Sequence (deletions in lower case):

TTGGTTAGACAAGCCACATGATCTAAGAAAACACTAATTTGGCAAAAAGCTAGGCAAAAAGTGagcagcgggcaattgacggactgcactgactttggtctctgaaaattcagttgtgatcattttttttctaaagcattatttaaaaatagggacaaaggagcatttcattaacaatttattggtcttttcattatgctctctcaaggaccccccatgagatcttctgaacaggttctaagacccgctgttctgcagccgtctcaaactcagagttgtcagaaagcaggcacaacatttgggcccggtgcattgaaatcctacaaaactaaggaaaaggccgagcacgaggtaagaaaaatccccggtgacagaagcaacagtgaaatgttcttggtaatcttaggaaatgagagagtgctccccggaccagatttcgtagttgctgtcactcccaagtggaaaaactgtgcggcaggcagtgggaactcatgagtgtagtaggactgccagaatgatgacagtataaaacgctgggggaggggggcagtgagatgggcacgggcggaacctgtagtcaaataatgggtagggtgttctgcatccccagctgtccaacatcagAGTGGAGCAAGCTTTGTCAGCTTAGTTCACACTAGACACATCTTCATGGATAACAGCAGCAA

This mutation is a 561 bp deletion beginning at Chromosome 15 position 9,007,125 bp and ending after 9,007,685 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
66045 TCT AAG ACC CGC TGT TCT GC Wild type Forward A
66046 GCT CGG CCT TTT CCT TAG TT Wild type Reverse A
66047 TTG GTT AGA CAA GCC ACA TGA Mutant Forward A
66048 TTG CTG CTG TTA TCC ATG AAG Mutant Reverse A
66049 Fluorophore-1 CAG AGT TGT CAG AAA GCA GGC Quencher-1 WT Probe
66050 Fluorophore-2 AGT GAG TGG AGC AAG CTT TGT CA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
66045 0.40 uM
66046 0.40 uM
66047 0.40 uM
66048 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.