For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 038223
Protocol 45599: Probe Assay - Clba1<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 125 bp
Wild Type = 127 bp
>chr12:112774229+112774355 127bp CTTCTCAGCACCTCAACACG GACACCACTACTCAGAATCTCCAG |
Sequence
Wt Sequence (deletions in lower case):
CTTCTCAGCACCTCAACACGGAAACAGGGACAGTGTTCCCCACGTGTCCCcgacagggttttagatgtgcgagcctgtggtttttcactgtgttttacatagcctggagattctgagtagtggtgtcgtcggtcgtcagtgacggcaacaccaaccgagcacgcagccagggactaaatacacttatgttagagtggagtatttgggacaaggtgacctaatgtatgtacgttgctcctaaccttgggacgttcctcctttccagtccattcccagctatgagaaggtttttaggcttgcgtttcaagaagtcgccgtggaacaggctcctgaagacgtttgctccctggaccatttcttggaaagaagcaatgaaggggctgcatctgtgccgagactctggtaatgaacttagctcggaactgcgcCGTGGCGCTGTGGCTGCGTTTCTTGTGTGCTAATGTGGTTTCACAAAGCTTTTTTGGTTGTTCCTAGAGGGTGCA
This mutation is a 378 bp deletion beginning at Chromosome 12 position 112,774,279 bp and ending after 112,774,656 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64069 | TGC ACC CTC TAG GAA CAA CC | Mutant Reverse | A | |||
| 65984 | CTT CTC AGC ACC TCA ACA CG | Common | A | |||
| 65985 | GAC ACC ACT ACT CAG AAT CTC CAG | Wild type Reverse | A | |||
| 65986 | Fluorophore-1 | CCG ACA GGG TTT TAG ATG TGC | Quencher-1 | WT Probe | ||
| 65987 | Fluorophore-2 | TGG CTG CGT TTC TTG TGT GC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64069 | 0.40 uM |
| 65984 | 0.40 uM |
| 65985 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.