For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr1:134196854+134196954 101bp AATGGAAGGCTTTGTTCTCC GAGAAAGCAAGTGTGGGTTCC
Mutant= 107 bp
Wild Type = 101 bp
The common primer (primer 65605) anneals over the nucleotide sequence containing mouse genomic variations rs30878889.
Wt Sequence: aatggaaggctttgttctcccggtgaagaggcagctcgagctgtaggaacgtcgtAggtaggagctgtgatgtctagcccggaacccacacttgctttctc
Mut Sequence: aatggaaggctttgttctcccggtgaagaggcagctcgagctgtaggaacgtcgtATcggggctcaaaaggttcatcctgctaagaggctctggatgaaagtccagg
A 1002 bp deletion beginning at Chromosome 1 position 134,124,648 bp and ending after 134,125,649 bp.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
65605 | AAT GGA AGG CTT TGT TCT CC | Common | A | |||
65606 | GAG AAA GCA AGT GTG GGT TCC | Wild type Reverse | A | |||
65607 | CCT GGA CTT TCA TCC AGA GC | Mutant Reverse | A | |||
65608 | Fluorophore-1 | AAC GTC GTA TCG GGG CTC | Quencher-1 | MUT Probe | ||
65609 | Fluorophore-2 | TAG GTA GGA GCT GTG ATG TCT AGC | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
65605 | 0.40 uM |
65606 | 0.40 uM |
65607 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |