Protocol 45719: Probe Assay - Extl1<em1(IMPC)J> Alt1
Version 2.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  116 bp

Wild Type = 98 bp

>chr4:134365004-134365101 98bp ACAGCAGGGGCAACCTCTT AAGGGAGCCTGAGACACCTG

Sequence

Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):

ACAGCAGGGGCAACCTCTTGtgattgagggaatgtcactgtaaggtggcaggggccactggagctgcacggtgaggggcaggtgtctcaggctcccttcctgtaccttctcaggacctacccaggagagacccttcccaatgccaccttctgcctcatccctggtcaccgatctgccacctcctgctttctccaagcccttcaggtacaccccaatctggatattccccagcctcagtacctctgcccttgcactggcaggagattctgggcacatgcacataggaagggggttccctgtacccccaaatactcctctttgtcctttcccttaacaggggggctgatggtggcctggggtggtggtgaatgtgtgcaagcgctgggctccccaatgactgccctgccccccaggccggctgcatccccgtgctcctcagcccccgctgggagctgcctttctctgaagtcatcgactggaccaaggcagccatcattgctgatgagagactcccactgcaggtagctcagggtctgtgtcatggtggggggggggaatgtcaggggagggaccccaggatctcggcccccttctagtagtcattcttatacctattgcttccctctagggcagtcatagatgtagttgaagggaaggctctagagggtgctgagagcaagttctgaaccactttcttccttggttttcccatctgtataatgggataagttagatctctagggatcatctgaaagtaaacagataagatgccatgtctcttccatctGATGAAATGAATGTTGCCCAGGCCAGAAGCATCTCTGTGAGCAGCTGT

This mutation is a 767 bp deletion beginning at Chromosome 4 position 134,364,315 bp and ending after 134,365,081 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
65440 ACA GCA GGG GCA ACC TCT T Wild type Forward A
65441 AAG GGA GCC TGA GAC ACC TG Wild type Reverse A
65442 CCA GGT CAC TGC TCT TGG TTA Mutant Forward A
65443 ACA GCT GCT CAC AGA GAT GC Mutant Reverse A
65446 Fluorophore-1 CCA CTG GAG CTG CAC GGT Quencher-1 WT Probe
66294 Fluorophore-2 CCT CTT GGA TGA AAT GAA TGT TGC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
65440 0.40 uM
65441 0.40 uM
65442 0.40 uM
65443 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.