Protocol 45578: Probe Assay - Fscn3<em1(IMPC)J> Alt 1
Version 2.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr6:28431510+28431606 97bp AGATGCTGAGGTGTGTGCTG TGAACGAAGTTGCAAGGTAGG

Mutant=  92 bp

Wild Type = 97 bp

Sequence

Wt Sequence: aaggtggaggagggagaagtacagggaaagccagcaattagcacagCcaaggggctggggcggagctaagaaggggctggggcggagctaagaagggtctggggcggagctaaaaagctgcttgcataccttctcctc

Mut Sequence: aaggtggaggagggagaagtacagggaaagccagcaattagcacagCCctagacatactttctccttccccggcatgtgtggcgagataaga

 

A 263 bp deletion beginning at Chromosome 6 position 28,431,420 bp and ending after 28431682 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
65461 AAG GTG GAG GAG GGA GAA GT Mutant Forward A
65462 TCT TAT CTC GCC ACA CAT GC Mutant Reverse A
65464 Fluorophore-1 CAA TTA GCA CAG CCC TAG ACA TAC T Quencher-1 MUT Probe
65940 AGA TGC TGA GGT GTG TGC TG Wild type Forward A
65941 TGA ACG AAG TTG CAA GGT AGG Wild type Reverse A
65942 Fluorophore-2 TCT GAG CGT TTG ACC CAG AT Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
65461 0.40 uM
65462 0.40 uM
65940 0.40 uM
65941 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.