For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr2:158000978-158001057 80bp CTGGACATTCGAGAGCGATG TGCTGTTTTTCAGTGGCTTT
Mutant= 110 bp
Wild Type = 80 bp
The common forward primer (primer 65238) anneals over the nucleotide sequence containing mouse genomic variations rs27309128 and rs218935467.
Wt Sequence: ctggacattcgagagcgatgtataagagttgtcctGaggcgggaaagtgcctcacctgctaaagccactgaaaaacagca
Mut Sequence: ctggacattcgagagcgatgtataagagttgtcctGCaagagggagctgagtcccctaccttgaaaactgtgaagcctagtgggttcactgagtccccaaggcaaagagt
A 4131 bp deletion beginning at Chromosome 2 position 157,996,891 bp and ending after 158,001,021 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
65238 | CTG GAC ATT CGA GAG CGA TG | Common | A | |||
65239 | TGC TGT TTT TCA GTG GCT TT | Wild type Reverse | A | |||
65241 | ACT CTT TGC CTT GGG GAC TC | Mutant Reverse | A | |||
65243 | Fluorophore-1 | TCC TGC AAG AGG GAG CTG A | Quencher-1 | MUT Probe | ||
65244 | Fluorophore-2 | CGG GAA AGT GCC TCA CCT | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
65238 | 0.40 uM |
65239 | 0.40 uM |
65241 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |