Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr4:41728303-41728383 81bp TTCTCCTCTCCCTGTATTTGC TCTATCTACGCGACCTGTCC
Mutant= 100 bp
Wild Type = 81 bp
Wt Sequence ttctcctctccctgtatttgccacgtgcaaggtctgagctaCctagaggcaccactagctaggacaggtcgcgtagataga
Mut Sequence:
ttctcctctccctgtatttgccacgtgcaaggtctgagctaCACTCATTAACCTGGtgagatcaattaggaaggtgggagggagaactggtcaggactgg
A 517 bp deletion beginning at Chromosome 4 position 41,727,825 bp and ending after 41,728,341 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000527822 (exon 3) and 444 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 103 and early truncation 3 amino acids later. There is a 13 bp insertion (ACTCATTAACCTG) at the deletion site.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
65211 | TTC TCC TCT CCC TGT ATT TGC | Common | A | |||
65212 | TCT ATC TAC GCG ACC TGT CC | Wild type Reverse | A | |||
65213 | CCA GTC CTG ACC AGT TCT CC | Mutant Reverse | A | |||
65214 | Fluorophore-1 | AGC TAC CTA GAG GCA CCA CTA GC | Quencher-1 | WT Probe | ||
65216 | Fluorophore-2 | CAT TAA CCT GGT GAG ATC AAT TAG GA | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
65211 | 0.40 uM |
65212 | 0.40 uM |
65213 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |