For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 128 bp
Wild Type = 127 bp
>chr5:139353973+139354099 127bp CCATCTTCCAGCACATCCA TCCTGTCTTGCAATAGGCTGA |
Large deletion: Mutant sequence with junction in uppercase
ccatcttccagcacatccagcgaggtgggggtaggtgggcattggggttccttgccagatgggggggagactaggCCtggagtgggcactgatgttgggtgaacccccagtaaacaccagtgctttcc
This mutation is a 1837 bp deletion beginning at Chromosome 5 position 139,354,049 bp and ending after 139,355,885 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
65184 | CCA TCT TCC AGC ACA TCC A | Common | A | |||
65185 | TCC TGT CTT GCA ATA GGC TGA | Wild type Reverse | A | |||
65186 | GGA AAG CAC TGG TGT TTA CTG | Mutant Reverse | A | |||
65187 | Fluorophore-1 | TGG ATT GGT ACT AGG GAG AGA CAG | Quencher-1 | WT Probe | ||
65188 | Fluorophore-2 | AGA CTA GGC CTG GAG TGG GC | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
65184 | 0.40 uM |
65185 | 0.40 uM |
65186 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |