For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 111 bp
Wild Type = 100 bp
>chr7:27354755-27354854 100bp TTTCTCCTTGCAATGTGCTG TCATGGAGGAGGCTGGAA |
Large deletion: Mutant sequence with junction in uppercase:
tttctccttgcaatgtgctgttcatgcctatgccctagAGgggatgggaattctgtacagagtcagtctttttgccttgtgagAAatgtGttagaccttcagaactctgca
This mutation is a 3202 bp deletion beginning at Chromosome 7 position 27,351,614 bp and ending after 27,354,815 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
65048 | TTT CTC CTT GCA ATG TGC TG | Common | A | |||
65049 | TCA TGG AGG AGG CTG GAA | Wild type Reverse | A | |||
65050 | TGC AGA GTT CTG AAG GTC TAA CA | Mutant Reverse | A | |||
65051 | Fluorophore-1 | CCT ATT ACC CAG GGG TGT CCA T | Quencher-1 | WT Probe | ||
65052 | Fluorophore-2 | ATG CCC TAG AGG GGA TGG GA | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
65048 | 0.40 uM |
65049 | 0.40 uM |
65050 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |