For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 129 bp
Wild Type = 129 bp
>chr1:92642119-92642247 129bp CCCATCTTCTAGCCAATCCA ACACCGCACAGCACGAGTT |
Large deletion: Mutant sequence with junction in uppercase
cccatcttctagccaatccattactgcctgcgaatcctaaacagtagcCTctttatcagagctgctgctagtacaagaccccaggtcagaggactccgggtgccccgggtggagactctgaaggaggtg
This mutation is a 5306 bp deletion beginning at Chromosome 1 position 92,636,893 bp and ending after 92,642,198 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
63604 | CCC ATC TTC TAG CCA ATC CA | Common | A | |||
63605 | ACA CCG CAC AGC ACG AGT T | Wild type Reverse | A | |||
63606 | CAC CTC CTT CAG AGT CTC CA | Mutant Reverse | A | |||
63607 | Fluorophore-1 | AAC AGT AGC CAT TCG GAT GGT T | Quencher-1 | WT Probe | ||
63608 | Fluorophore-2 | CAG TAG CCT CTT TAT CAG AGC TGC TG | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
63604 | 0.40 uM |
63605 | 0.40 uM |
63606 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |