For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr4:48552312+48552416 105bp TCCTCTGTGACTTGTGACATTT GCATTTTCCACTCTATTTCTCC |
Mutant= 80 bp
Wild Type = 105 bp
Large deletion: Mutant sequence with junction in uppercase
tcctctgtgacttgtgacattttgtagtattaGGgggttaggatttatacccactctcaccaacgtgtttggagatacgg
This mutation is a 9774 bp deletion beginning at Chromosome 4 position 48,552,345 bp and ending after 48,562,118 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
62922 | TCC TCT GTG ACT TGT GAC ATT T | Common | A | |||
62923 | GCA TTT TCC ACT CTA TTT CTC C | Wild type Reverse | A | |||
62924 | CCG TAT CTC CAA ACA CGT TG | Mutant Reverse | A | |||
62925 | Fluorophore-1 | TTT GCA GGC TAG CCA ACG A | Quencher-1 | WT Probe | ||
62926 | Fluorophore-2 | AGT ATT AGG GGG TTA GGA TTT ATA CCC | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
62922 | 0.40 uM |
62923 | 0.40 uM |
62924 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |