For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr6:67015556+67015653 98bp GGTTTTGTAGATACTCTGGCACA TTGAAGGAGACTGGCTGCAT
Mutant= 97 bp
Wild Type = 98 bp
Large deletion: Mutant sequence with junction in uppercase
actgattcgtgctaaatttctgcagaaaggttttgtagatactctggcacatctagatcgtcaccaaaattaCGgatggcgtgaggaaggtggggtgctgacatttatcgctatccttgcagcat
This mutation is a 5857 bp deletion beginning at Chromosome 6 position 67,015,601 bp and ending after 67,021,457 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
62653 | TTG AAG GAG ACT GGC TGC AT | Wild type Reverse | A | |||
62654 | ATG CTG CAA GGA TAG CGA TAA | Mutant Reverse | A | |||
62655 | Fluorophore-1 | ATT TCT GGC TGG GAT ATT TGG | Quencher-1 | WT Probe | ||
63347 | GGT TTT GTA GAT ACT CTG GCA CA | Common | A | |||
63519 | Fluorophore-2 | AGG AAG GTG GGG TGC TGA CA | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
62653 | 0.40 uM |
62654 | 0.40 uM |
63347 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |