For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr2:27113699-27113795 97bp AGGCGGATGCCTAGTCTGT GCCTCTATGCAAAGCCACTA |
Mutant= 96 bp
Wild Type = 97 bp
Common Forward Primer (62628) anneals over the sequence containing genomic variation rs257721679.
Large deletion: Mutant sequence with junction in uppercase
aggcggatgcctagtctgtggtgaacacattctgggggattgccttctCGgcacagactctccctggaagcagatggagtccaccttcccagatca
This mutation is a 3410 bp deletion beginning at Chromosome 2 position 27,110,337 bp and ending after 27,113,746 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
62628 | AGG CGG ATG CCT AGT CTG T | Common | A | |||
62629 | GCC TCT ATG CAA AGC CAC TA | Wild type Reverse | A | |||
62631 | Fluorophore-1 | CTT CTC CCT CTT GAT GGT CTT GTA GA | Quencher-1 | WT Probe | ||
62632 | Fluorophore-2 | ATT GCC TTC TCG GCA CAG ACT C | Quencher-2 | MUT Probe | ||
63891 | TGA TCT GGG AAG GTG GAC TC | Mutant Reverse | A |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
62628 | 0.40 uM |
62629 | 0.40 uM |
63891 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |