For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 037109
Protocol 42613: Probe Assay - Rnf187<em1(IMPC)J> Alt 1
Version 2.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 134 bp
Wild Type = 134 bp
chr11:58932161-58932294 134bp TCCAGCCTCTCTGTTTCCATA CCCATCCTGGAATATCTTAGTGA
The common primer (primer 60064) anneals over the nucleotide sequence containing mouse genomic variations rs241612121 and rs266215563.
Sequence
Wt Sequence (deletions in lower case):GCCAGTTTTATCCTGCTTCAGGGCTGAAGGTATAGCGATAAGTCACCCTGGAAAAGCCTTTCCTGACAGACCACCTCCCAAATTATCTGTGGGAGATGGGCAATTATTCATGATGTTGGGGCAGTACCCTgcaggatgagtaatcttataggacacaggg[....]gtcaggggccaaagacatagatgtatttaggtttcgggtaacaatgttctgtccccagaaggccccagccttggatgtagtgaccggcctcaacttgactcgcaggtgggctgggttttcagtgctgaataaagtggtttgctccagcctctctgtttccatacctcctagtctttgtctacacagctgcttcccccttccctgaccagGTTCCAAGGACTTTGATACCTTTGAAAGCAAGATAAGGAGACTGTCACTAAGATATTCCAGGATGGGGTGTGGGTGTGGGTGTGTGTCATCCCAAACCCAGCGTTGGCTGT
This is a 6959 bp deletion beginning at Chromosome 11 position 58,823,054 bp and ending after 58,830,012 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 60063 | TCC AGC CTC TCT GTT TCC ATA | Wild type Forward | A | |||
| 60064 | CCC ATC CTG GAA TAT CTT AGT GA | Common | A | |||
| 60065 | TGA CAG ACC ACC TCC CAA AT | Mutant Forward | A | |||
| 60067 | Fluorophore-1 | TCT TTG TCT ACA CAG CTG CTT CC | Quencher-1 | WT Probe | ||
| 61120 | Fluorophore-2 | TTG GGG CAG TAC CCT GTT CC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 60063 | 0.40 uM |
| 60064 | 0.40 uM |
| 60065 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.