Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 135 bp
Wild Type = 130 bp
chr11:77476814-77476943 130bp GGTACTAGAGACAGCGTGAGCA GGCGGTACAGCTAGAAAAGAAC
The wt reverse primer (primer 59965) anneals over the nucleotide sequence containing mouse genomic variations rs214155141 and rs240652107.
Wt Sequence (deletions in lower case): TCAGTAAATACCTGTTGAAAGCTTGGATGAGGTTGAATGGTGGCATGAACGCACCGTGGGTACTAGAGACAGCGTGAGCAAGCCATCCCCatgcccagcctcagattgtttaaatctccgttaggggtgggggtgaaggaagaacctctcccgagtgagctccctagttcttttctagctgtaccgccagctccaacgcctgtgccccgagctggcccaggaagctgagtcctttctgaacttcccttccacccagtgcctctggtatccaagatttgccctagtgacacatacaaagtgtggaagagtgggcagaacctgagggtagacaccacgcttttgggctttgaccatatgacctggcagagggggaatcgcagcttcgtcttcagaggtcaaggtcagtgaggcagtaagtctggcagggtgggagacagcggacagccccagactgccctgacccctgtgctgttccctggtggcagacacaagtgctgtggtcatggagattgaccatgaccgccgcgtggtgtacatggagaccctggcgctggccgggcaggatcgggagctactgctggctgccgcccagccctcggaggaacaggtgctgagcaggcttactgcgcccgttgtcaccacacagctcgacaccaagaacatctcctttgagaggtgagctggtgtagcctgggtggccaggagccagcccgatgggccattctttcacctggaccactctacctccccaggaacaagactggcattctgggctggcgcagtgagaagacagagatggtgaacgggtacgaggccaaggtgcgcacactcctgatccactttccccagcctgtgggtgcagaggcaacccagcatggaggaaaggcaggagaccaacaggttccccaggagaaggccgtttgcagaatccttagggtagtcacatccaaggctctgttcagacacgctgtatgggtgcagagaaacttgtaccaccctcatttcctccccacaacaggcagatgctcttatccccactctatagatgaggtactgagctttccccacagaccccacttaatcttaagcactccaccaagCTGGGGTTGCCGGTTGTTATCCTGGACTACAGATGAGGCCACGAGGATTGGAGTGGCTCACTGACCTAGTAGAGG
This is a 1010 bp deletion beginning at Chromosome 11 position 77,366,728 bp and ending after 77,367,737 bp (GRCm39/mm39). There is a 4 bp insertion AGGA at the deletion site.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
59964 | GGT ACT AGA GAC AGC GTG AGC A | Common | A | |||
59965 | GGC GGT ACA GCT AGA AAA GAA C | Wild type Reverse | A | |||
59966 | GTA CAC ATA GCC TGT AAG TGC TTC | Mutant Reverse | A | |||
59968 | Fluorophore-1 | TGA AGG AAG AAC CTC TCC CGA G | Quencher-1 | WT Probe | ||
61474 | Fluorophore-2 | CAT CCC CAG GAC TGG GGT T | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
59964 | 0.40 uM |
59965 | 0.40 uM |
59966 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |