Protocol 42239: Probe Assay - Zfp628<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  114 bp

Wild Type = 109 bp

chr7:4921736+4921844 109bp TCCAGTGCTTGCTCATTCTG CCTGGCTTTTCCCCAGTTC

Sequence

Wt Sequence (deletions in lower case):

TAAGGAAGAGCCCCCACAGCATGGGCGACACAGGGAGGCTGCCCCTGTTCCTTGAAGAGCCGCTGTGAGTGGTGAGGAGGTCCAGTGCTTGCTCATTCTGATCAGAATCCTTTCACCAGGTGTGATGGCCGGCTCCCacgtggacatggcgccagcttccaccaccgagggaactggggaaaagccagggcccactgcgccagcacccaccccagctgctcagtatgagtgtggggaatgcggcaagtccttcaggtggtcatctcggctcctgcaccatcagcgcactcacacaggtgaacggccctataaatgcccggactgccccaaagccttcaagggttcctcagccctcctctaccaccagcggggccatacaggcgagcggccctatcagtgcccagactgccccaaagccttcaagcgctcttccttgctgcagatccaccgcagtgtgcacacaggcctgcgggccttcacctgcggccagtgtggtctggccttcaagtggtcatcccattaccaataccacttgagacagcataccggtgagcggccctacccgtgccctgactgccccaaggccttcaagaactcctccagcttgcggcgccaccggcatgtgcacacaggagaacgcccttacacctgtggcatttgtgggaagagctttactcagagcaccaatctgcggcagcaccagcgggtgcacacgggcgagcgccccttccgttgcccactctgccccaagaccttcacacactcctccaacctgctgctgcaccaccgcacccacggccctgcccccggccccgcccctgcccccgcccccccaggggagaccagcagagctgacaccaaggttctggtctctgatgcctacttgcagccccgtagcccgcctgagcctccagccccaccaccccagcccccacccgtggtgcccgagctttttttggctgctgctgagactacagtggagctagtgtaccgctgcgatggctgcgagcagggcttcagcagcgaggagctcctcctggagcaccagccatgcccggggccccctgtagccacccagtcccaggatgtgcctgccgagctgccccaggctgactccgccctaccacagcccccacctgccactccaggccctcctaactttgcttgtcttccttgtgggaagtccttccggacggtggctggcctgtcccgtcaccagcacagccatggtgcggccagtggacaggcctttcgctgtggcagctgtgatggtgccttcccacaactggccagcctcttggctcaccagcagtgtcacgtggaggaggcggcagccggacgcccacctccccaggctgaggttgcggaggtcacctgtccccaggaacctgtagccccagccactcctgccccaccccctcctcctccacctgccccggtggtttctgcagagcggccctacaaatgtgccgagtgtgggaaggccttcaagggttcttccgggctgcgctaccaccttcgggaccacacaggtgagcggccctaccagtgtggggagtgcggcaaagccttcaaacgctcctccctgctggccatccaccagcgtgtgcacacaggcctgcgagccttcacctgcggccagtgtggcctcaccttcaagtggtcgtcccactatcagtaccatctgcgacttcactcgggtgagcggccctatgcctgcactgagtgtggcaaagccttccgtaacacttcgtgcctgcggcgccaccggcatgtgcacaccggtgagcggccccactcatgtagtgtgtgtggcaagagcttcgcacagacgtccaacttgcggcagcaccagcgggtgcacacgggcgagcgccccttccgttgcccgctctgccccaagaccttcacacactcctccaacctgctgctgcaccagcgcactcattctgccgagcgcccttttgcctgccccatttgtggccgtggctttgttatggctgcctacctgcagcggcatctgaggacgcacaccccagccaccacaacttcgggcaccaccggctctgctgtagcatcgcagccccctgccccattggctgcagctccaactccactggctgctcaagatgttcacgtactccctaacctacaggccacactttcacttgaagtagctgggggaacagcccagcctacgcccccaggcccggctgctcccagttctcaaacatttctcctggtacagactgcccagggcctccagctgattccaagcagtgtccaatcccctactcctccacccccgcctccaccccctaaagtcattctgctgcctcctgccagtgctggaggtccgggcagtggtgctgcaaggccaggccctcggtctgttgggaaagctggacaggggacaggggtggtgtggtttccaggcccaggtggtctggggctgcaaggaggggccaatgcaggggctagcgggggagggcagagcctcattgttctgcagaatgtagggagtggggagacaggaccacaggaagtgagtggggtccagcttcagccagcacaggaagtggccacggtacaactacagcctgcacaggaagtgactacagtccagctacaaccagcacaggaggtgactacggtccagctccagcccctgacaggccaagtctccaattctaatggaggagctggcactacagaagctccaaacctgctgctggttcagagtggggcaactgaagagttgctgaccggccctgggcccggggaagtgggagacagtgaggccggtgctggtgtggtccaggacgtcctgtttgagacactgcagacagatgaggggctgcagagtgtgctggtgctgagtggggcggatggtgagcagactaggctctgcgtgcaggaggtggaaacgctttcccccggtctggcggagccagcggccactggcccatcaggacagaaactccttatcattcgtagcgccccagctactgatctgctagaaaatagcagcgttgcaggaggcaccacaacactgcaactcctggccccgtcagcacctggcccggtctctgcccctgtgggggtgcccgtagctcccccgtcccagatggtacaagtggtccccgcagtggctggaccaggggtcatggctccccagaacttgccctccatccagattgtgcagactcttcctgcagtccaactGGTACACACGTTTTGAAGAGACCCCCTCCCCGCAATTAACTGTTCTCCTCAGCTGGGCTGGGGTCAGCCCCAGAGTCAGGGGGGCTGCTGGCTGGACTTGCTAATAAAGACCCAGAATCTCTTCCTGGTTTTGTTTTCATGGGGGAGGTATAGTCATGGGCATAGCCCCTGCTTCAGACCTGGAAGTCTTCATTCTTGCTTCCCGGATCTGAGGTGACTTGCTTTGTACTTGGAGGGCTAAATGCTT

This is a 3088 bp deletion beginning at Chromosome 7 position 4,921,793 bp and ending after 4,924,880 bp (GRCm39/mm39). 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
60195 TCC AGT GCT TGC TCA TTC TG Common A
60196 CCT GGC TTT TCC CCA GTT C Wild type Reverse A
60197 Fluorophore-1 TGG ACA TGG CGC CAG C Quencher-1 WT Probe
60198 CCC AGC TGA GGA GAA CAG TTA Mutant Reverse A
60199 Fluorophore-2 CCG GCT CCC GGT ACA CAC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
60195 0.40 uM
60196 0.40 uM
60198 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.