Protocol 41950: Probe Assay - Elavl2<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  152 bp

Wild Type = 167 bp

chr4:91281147-91281313 167bp GAGCTTGGGTTACGGATTTG GGGCCCAAATGAAAAGTACA

Sequence

Wt Sequence (deletions in lower case):GTCTGTAGTAACTGTAGTTTCGAAATGTGGTAATGTGTCAGTCTGCGTGATAAAACACTGACAGATTCTGGGTTGCTGTTTCTATCTTCCGTCTCGCTCCGAGCTTTCTCTATGTCTTCTGGAGCTCCGCAGAGAGGTGCACCCAGTTTTGGGGCTGCTGCCATGTCCTGGATTAGGCATGTGATGTATGATGGGATGGCCTGGGcctgtgtggtttcataagcagcactgcttgctgagttctaaagatatctaaatttacaaatgacaggagcctgtgctaaaagctaagtcacctcctgtccgtgggtttgaactaacatgcctctcctcttccgtctcctcagggcagagcttgggttacggatttgtgaactacattgaccccaaggatgcagagaaagctatcaacactctgaatggattgagacttcaaaccaaaacaataaaagtatgttcacacttttcttaagtttgcttgtagaataagagtttatttgtacttttcatttgggccccgtgagcctgtcTGTGAGTCATACAGTATAATGTTTTTGTACTTATTGAACAAAGGAGGCAACTTTAATATTATATGTGGACATTTATATTAGCAGAAAGAGCAACAGTGCCCTCCGATATATACTGTATAAAGCCCCTAAATTAAGTCCTTATAGAGAGACTCCTTGAACTATTACTGGAGGGATTGTTGCACTTGTCTGAACAGCAATAGTTAGTGTTGTTTTGTAAGCCAGAAAGGCTCAGCCGTGTTTCTCACCTCTGCCCTTGACACAGATTATGAC

 

This is a a 325 bp deletion beginning at Chromosome 4 position 91,169,372 bp and ending after 91,169,696 bp (GRCm39/mm39).


 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
59512 GAG CTT GGG TTA CGG ATT TG Wild type Forward A
59513 GGG CCC AAA TGA AAA GTA CA Wild type Reverse A
59514 Fluorophore-1 AGC TAT CAA CAC TCT GAA TGG ATT GAG Quencher-1 WT Probe
59515 CCT GGA TTA GGC ATG TGA TG Mutant Forward A
59516 GTA TAT ATC GGA GGG CAC TGT TG Mutant Reverse A
59517 Fluorophore-2 ATG GCC TGG GTG TGA GTC ATA C Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
59512 0.40 uM
59513 0.40 uM
59515 0.40 uM
59516 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.