Protocol 42422: Probe Assay - Fbxo3<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr2:104042846+104043011 166bp ACTTGCGTCTCGGGTGTGT CCACTAACTTTTGCCCGTTG

Mutant=  180 bp

Wild Type = 166 bp

The WT Forward primer (primer 60656) anneals over the nucleotide sequence containing mouse genomic variations rs219604498 

The Mut Forward primer (primer 60658) anneals over the nucleotide sequence containing mouse genomic variation rs224815574

The Mut Reverse primer (primer 60659) anneals over the nucleotide sequence containing mouse genomic variation rs260031365

Sequence

Wt Sequence (deletions in lower case):

CCCAGCAAGTGAGGGGCAGTTGCTTGGAAGAGCATCACTTCTTTTGGTATTTGTAGGTTTTTCTCTTGTGACAGCTAGAATGCAGGCCATGTTTTCTAATGTGCAATGGAGAATTCAACTTAGTGGCTTCTCACAGTATGAATCTACATCTATCTACTGCCTTCCACTTCCCATAAAGGGTTCAAGTTGAACCTCTAGAATGACGTCAGCTGAGAGAACTTCCAGAGCTGTTTTTAAATGAAGTATTGAATATATCAGGTTTGGAAAAGTGAGACAAGAGCTTTGTTATAATGTAATAAATTAATTGTTCATTTCCTTGGTGCCCCTTTCCAATTCTTTGTGCCAGTGTTTTTTTCCcacgttgagaggaaacaaacctcttttgtttagtgtttaaaattattttccaattcagtgtctggtattttgacagtatattttaaacggaattcacttgtcataagatggtttcatgggttgacagctgacctagactaccctgaagtctgagtgtgcgcacacacttgcgtctcgggtgtgtatttgcgcacacacttgtgtctcgggtgtgtatttgcagagggcgcacgtgaggaagacctggatgctgtcgaagctcagatcggttgcaagctcccggatgattatcgctgttcataccggatccacaacgggcaaaagttagtggtgccggggtaaggtgtttgatgttttagtaattttcagaaatgggtattactttctagaatgaatcaaattacattttattcatagtttttcttagctatctttactaaacatgtataagaaatgtatgtatgggggggttccttccttttccttatagCAGTCCATAATGTAATATGTATAGATTAAGTTAAAGTTTACCAAAATAAATGTGACTTATAAGAGCATTATTCCTGCCAGCACATTTTTATGATTAAAGTAAGATCTGGTTGAGAAGGAAGCTGTGGGTGCAGGAGGGGATGTGCATGTGTGCATATTTGTGCATGTGTGCATATTTGTGAGTGCATTTGACTGAATGGCTTGATGTGGTG

 

This is a 490 bp deletion beginning at Chromosome 2 position 103,873,026 bp and ending after 103,873,515 bp (GRCm39/mm39)

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
60656 ACT TGC GTC TCG GGT GTG T Wild type Forward A
60657 CCA CTA ACT TTT GCC CGT TG Wild type Reverse A
60658 GTT TGG AAA AGT GAG ACA AGA GC Mutant Forward A
60659 GCT GGC AGG AAT AAT GCT C Mutant Reverse A
60660 Fluorophore-1 ATG ATT ATC GCT GTT CAT ACC GGA Quencher-1 WT Probe
60661 Fluorophore-2 CTT TCC AAT TCT TTG TGC CAG TG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
60656 0.40 uM
60657 0.40 uM
60658 0.40 uM
60659 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.