Protocol 42244: Probe Assay - Lmod1<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  145 bp

Wild Type = 138 bp

chr1:135363451+135363588 138bp CCAAACCTGAGGCCATGA GCTTGTCTAAGTGCCCTTCTG

Sequence

Wt Sequence (deletions in lower case):

AAGGTCTAAGATGCTCTGTGGAAGAGCTGATGTCTGCAGGTTTTCAGGTGCATGTGGCCCAAACCTGAGGCCATGAGGCTGATGTCAATCCACTCTCCTGAGTCCAGAACCCAGTCCTACCTctacagaactcaaccgaagaaggctgtcaaccttcccctagttaaatgtccttcagaagggcacttagacaagcccctccctgactggtctgcgcatgcgcttcctccctctgtggctagctctacatgtttatttttcttttctgaattcttaggaaagcaagcaagtggggaggaagacagatgccaagaatggagaggagaagga[...]gcggggattaaaggtgtgtgctaccacaccgggccagtctccagactttaagtctcctttagaacctttcacctttgcatgtttttgtttgtttgtctgtttgtttgtttacttaactggaaacacgatttagactgggctgggggctgggagcacacacacttcccaactctctgcttcccagagccaattaggcCTGGGATGACGTAATCATTTCTAAGTGCGTTTAAACTTGATGTGGGAGCGCAGCGCCACCTCGAGGAA

This is a 4824 bp deletion beginning at Chromosome 1 position 135,291,253 bp and ending after 135,296,076 bp (GRCm39/mm39).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
60206 CCA AAC CTG AGG CCA TGA Common A
60207 GCT TGT CTA AGT GCC CTT CTG Wild type Reverse A
60208 CTG GGT TGC AGT TTT CCT C Mutant Reverse A
60209 Fluorophore-1 ACC CAG TCC TAC CTC TGG GAT G Quencher-1 MUT Probe
60210 Fluorophore-2 TCA ACC GAA GAA GGC TGT CAA C Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
60206 0.40 uM
60207 0.40 uM
60208 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.