Protocol 41775: Probe Assay - Zcchc2<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  83 bp

Wild Type = 110 bp

chr1:106000997+106001106 110bp CCTCCAGACGGACTCACTGT GCAGCAAGAGCAACAACTTC

Sequence

Wt Sequence (deletions in lower case):

AGTAGATAAACTTTATGTAATGATTAGCATACACAGTACCTCGGGAAATTAACATAAAGTATACTAGTTATTTTATATGTCCTTTTGATTCTGGTTCATGTGGTATAGAATGAATACCACTGGTAACTCTGattagcaacattggatttctgtgtgtaagatagctgggaaagaaaatatttgaaaagattattacttttaaataaaaatgagcattgatactgctacttgtgactctgacacatggtatctttttacccttaatgtttaatcacttgtaactagtataatcattattcagactgtatgacttgactctgtggaattttctcctctgatgtagattaacacattttctcttctagaacgactctgcctgtggtgactatatacagagtaatgagactggtttagtagagcaagcccagatacctccagacggactcactgtggcccctcatcgagctcagcgagaaggtgtgctgcatttgttgttttcacactgatcATCATAGGGTTTTGAAGTTGTTGCTCTTGCTGCTGGTGATGATGGTGGGTGGGTGGGTGGTTGGTTTGTTGGTTGAGAAAGGGTCTCACATAGCCCAAGTTAGCCCAGATTCACTATATATCTAAAGCTGAC

This is a 377 bp deletion beginning at Chromosome 1 position 105,928,427 bp and ending after 105,928,803 bp (GRCm39/mm39).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
59125 CCT CCA GAC GGA CTC ACT GT Wild type Forward A
59126 GCA GCA AGA GCA ACA ACT TC Common A
59127 CTT TTG ATT CTG GTT CAT GTG G Mutant Forward A
59128 Fluorophore-1 ACC ACT GGT AAC TCT GAT CAT AGG G Quencher-1 MUT Probe
59129 Fluorophore-2 AGC TCA GCG AGA AGG TGT GC Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
59125 0.40 uM
59126 0.40 uM
59127 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.