Protocol 41726: Probe Assay - Maco1<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  130 bp

Wild Type = 77 bp

chr4:134836179-134836255 77bp GGTTCCTTTCCCCAATATTATC CAAACAAAACCCCACAAATC

Sequence

Wt Sequence (deletions in lower case):

TTATTGGTAATGAATAGTGGTGTCCAGAGGAAGGCAGCATTATTAATATTACCACCAGCATATTTCTTGCCAATATTTTGGTTCATCTGCATTCCAGCAAGCTTTAAGAATGAAGCTCTTTAGGAATGGTTTATGAGGAAACAGGAAGCTTTTCAGTGTTAAAGTTCTTGTTCATTCAGGTAAAACCTGCCTATAGAATCCCAATGAATTCACTGTGGTCCAACCTCAGTTTCGGCCCAGTTCATGTCCTTGGCTTAAGAACCATGAACAAGAGCACTCTTTAATGTTGAATTAGCTACTGCTTTTTAGTATATGTGCTGCTCAAGCAAGCTTATAACCActgcttccccctggtctattctgagtgtttgaaatttcctcttgttaaattgctttgtattcagcaattttgttcaacaaagcttttaatagcatacttgaaattaacaaattctgaaatgtggcttttaatttggttttttttttctgtctttaggccttctcagtattttttgtttgtgtagcattcacttcaaatatcatatgtctcctcttcattcccatacaatggctttttttcgctgctagcacatatgtatgggtccagtacgtatggcacacaggtgagtcttaatgacttcttggttaggaattttagattcaagttaattatttagattgatattttaaggttcctttccccaatattatcttaatatgttgcttggcttgtggttgtggtttgttgatttgtggggttttgtttgttctttggttgtaggattggttatttgaggcagggtcttactagtaatcctggttgtcctgtaactcactatgtaggcCTGGCCGGTGTGGAACTCAGAGTGATCCTCCTGCCTCTGCCTTCTGAGTTCTGGAATTACAGCTGTGCCTTGCCTTACCCTGCTCTCGCTTGCATGCATGGTTTCCTTCTTTTTGATCTGAATGAAAAGCTTAGGTGTTAGGTCTTCTGGTTGGTCTCTAGTAAAGATGCCAGGTTAAAGGGTCAGGGCGGCTTCTGTTTAGGAGGCCTTGAAGACATTCGTGTGCCACACAAGACTGTTTACAACATTTTATTATTGAAAGGAATGCTAGTTAG

This mutation is a 505 bp deletion beginning at Chromosome 4 position 134,563,412 bp and ending after 134,563,916 bp (GRCm39/mm39).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
59011 GGT TCC TTT CCC CAA TAT TAT C Wild type Forward A
59012 CAA ACA AAA CCC CAC AAA TC Wild type Reverse A
59013 Fluorophore-1 ATG TTG CTT GGC TTG TGG TTG TG Quencher-1 WT Probe
59014 TGG CTT AAG AAC CAT GAA CAA G Mutant Forward A
59015 GCA GAG GCA GGA GGA TCA C Mutant Reverse A
59016 Fluorophore-2 AGC TTA TAA CCA CTG GCC GGT G Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
59011 0.40 uM
59012 0.40 uM
59014 0.40 uM
59015 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.