Protocol 41800: Probe Assay - Celf5<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  98 bp

Wild Type = 110 bp

Sequence

Wt Sequence (deletions in lower case):

TGGATGGATGGATGGATGGGTGGATGGATGGGTGGACAGATGGATGGATAGATGGATGACTGACTTCCTATTTAGCTGAATTAATGGCTGACATCTAAGTCTCTGGGCCTAGAAGATGTTGGTGTATCCTATCTGTTCGGGCCATCTTGGTCAGTCCTGCCTATGTCTGTATGAACTCATGTCAGCTGTTGTCCACgagtggcaatcaagggcttcttctctcccttgctcccatccattatattcttcagtccctcacctcctcctcccttccctcccaggctgtgccttcgtgaagttttcttcccacacagaggcccaggctgccatccatgccttgcatggcagccagactatgccggtgagtgagagctgcgcttggctgaggcggggctgggtgcaaggtgggtgggagagatgggtggttttggcatcttcccttcatagactgcttcagacaggaggctggatgtgcagcccaggctgtgatcagagctgtgtgtgaccagacactgtcctggggcaagtgtagttcttagcttgtggcagtaacaCAGGCTGAGAAGCAGGGGCAGCAGTTGGATGATGTGTAGAGATCATGGACCCTGTTCTAGGGCAGCTGGAAGCCACGGTGGGTGCACAGAGTGAGGGGAGCTGCCAGGTCATTTGCATAGGTCCTTCAGGTCAGGTCCGCCAGTGAACAAGGGACAGAAGGACACTAAGAACCTAGAGGGGCAGGT

This is a 358 bp deletion beginning at Chromosome 10 position 81,305,085 bp and ending after 81,305,442 bp (GRCm39/mm39). 

chr10:81469210-81469319 110bp GTGATCAGAGCTGTGTGTGACC CTCTACACATCATCCAACTGCTG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
59177 GGC CAT CTT GGT CAG TCC T Mutant Forward A
59178 Fluorophore-1 AGC TGT TGT CCA CCA GGC TGA G Quencher-1 MUT Probe
59179 CTC TAC ACA TCA TCC AAC TGC TG Common A
59180 GTG ATC AGA GCT GTG TGT GAC C Wild type Forward A
59181 Fluorophore-2 ACA CTG TCC TGG GGC AAG TGT AG Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
59177 0.40 uM
59179 0.40 uM
59180 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.