Protocol 41799: Probe Assay - Ttbk1<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  148 bp

Wild Type =165 bp

Sequence

Wt Sequence (deletions in lower case) :

ATACACATACAGAGACAGACAGAAACACAGACATACAGAGATACAGTCACAGAGAGCTCAACAGAGACAGAGACAGACAGACAGACACACACACACACAGAGATAGACAAAGACAAATAGAGAGACAGAGATCAAGAGTGCACcagagcctatctggctactgaggagaaaggaatgggactggggaggcccctgtgtttgtgctctccaggcaaggaccacgtgtgcaggttcattggctgtggccgtaacgagaagtttaactatgtggtgatgcagctccaggtgtgtccttggggtccgctcacttgcctctttgcccaagagctggagcgtggtgtgggtggggcatgtggcaggaggcatccgttcttgatgggatgggtacacaggggggcaaggctgggtggtgaatgtggctgagatgggtcttccccctcccaccctgtcccaccctgtcctcccagggccggaacctggctgacctgcgccgcagccagccaaggggcactttcacgttgagtaccacactgcgcctgggcaagcagatcctggagtccattgaagccattcactccgtgggcttcctgcaccgtgacatcaagccggtaagcagtgcgctgagagctcctgtggtctgtgggtcctcgcttctcCACGACAGTGCTGGGCCCTCAGAGCCTCCTCTCTTTGAGCACTTCTTGATCTGTACCAAAGCCACAGCCCCTCTTTCTCGCCTCTTGGCCAAGCCAGGTTGAATGCCCGGCTCTCCATTTGCCTTCATCTCTCACCCATGACCCTGTGTCTTCAGTCTAGAGGTGGCACCTAACTTTCTGT

 

This is a 513 bp deletion beginning at Chromosome 17 position 46,789,743 bp and ending after 46,790,255 bp (GRCm39/mm39).

chr17:46478769-46478933 165bp GGCAAGCAGATCCTGGAGT CAAGAAGTGCTCAAAGAGAGGAG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
59172 GGC AAG CAG ATC CTG GAG T Wild type Forward A
59173 Fluorophore-1 ACT CCG TGG GCT TCC TGC AC Quencher-1 WT Probe
59174 CAA GAA GTG CTC AAA GAG AGG AG Common A
59175 Fluorophore-2 AGT GCA CCA CGA CAG TGC TG Quencher-2 MUT Probe
59176 CAG TCA CAG AGA GCT CAA CAG AG Mutant Forward A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
59172 0.40 uM
59174 0.40 uM
59176 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.