Protocol 39822: Probe Assay - Dlx4<em1(IMPC)>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr11:95140773-95140865 93bp TTGGCCACCATAGAGTCTCC GAGCTGGGGCCTTTTACA

Mut = 98 bp

Wt = 93 bp

Fam = Mut

Hex = Wt

 

Sequence

MUT Sequence (junction in uppercase):

tggcggaacattaagctttccggacctgaatcactttccttctgaagcaaccgcgctggggcccgcaggaaataCCactgagccatctctccagcccaacattagattctcggtatgcctctgctgccagctagctctggggttctggctcaggaacattgtaacagcctgt

This mutation is a 2312 bp deletion beginning at Chromosome 11 position 95140139 bp and ending after 95142450 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
54698 TTG GCC ACC ATA GAG TCT CC Wild type Forward A
54699 GAG CTG GGG CCT TTT ACA Wild type Reverse A
54700 CAT TAA GCT TTC CGG ACC TG Mutant Forward A
54701 TCT AAT GTT GGG CTG GAG AGA Mutant Reverse A
54702 Fluorophore-1 ATT ACT GGT GGT GGC CCA G Quencher-1 WT Probe
54703 Fluorophore-2 CCC GCA GGA AAT ACC ACT G Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
54698 0.40 uM
54699 0.40 uM
54700 0.40 uM
54701 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.