Protocol 38189: Probe Assay - Tmc5<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr7:118647885+118647989 105bp TGTCACCCATGAAAAAGCTG TGGTGGAGGAGGACTTTGTG

Mut = 107 bp

Wt = 105 bp

Fam = Mut

Hex = Wt

 

Sequence

Wt Sequence (deletions in lower case):

AATCCCAGAAATGTGAGATTATGCCCCTATAGTGTATTAAGCAATAGTTGATGATCTTTTGTTGTAGAAACATGgatagtattctcataatctctctgtgaggttatattgttatccccatcatacagatgtggaaactgaggctcagaatacttaatggggcaagagccctctattggcagactttaggctttcaggctatgcctgtctgatcctgtcacctgtacaacattgtgctggtaattctcccttctttgagagaagaatttggactgcccatattacctttcattatcactgagtgacctgtctcatccctgcatgcctcaacaccttcataataatgtttgcacattttggtttctgccttcccccagtatggccaagtacttccggaacaacttcatcaacccccacatatactccagagggattgctaagctcatcttttgctgggacttcactgtcacccatgaaaaagctgtaaagctaaaacagaagaatctgagcacggagatcagggtaagtcccagactccagagtcctccccacaaagtcctcctccaccagccttcctcacccctgcgtgtctacagcttttttcctccccccccccctcctcttccctgcttttccttccctttcccaattccctttctctttccctttgtgatagggtttcagccaggctgaggtgtgtacatcttaatcccagcacctcaggagccaggggcaggtagatctttgagagttctaggctggggcgggggtgggtgggatggtggggtggagtggggtgaggggtgttcatgtgtatcacaagctgatctggaatttaagatcctccttcctcagacttcctggtgctgagattataaacctttgcctccactcgtggtcttgtctataaaatatttaattatggataacacccaatgccagccagtgcatggggacatcatgccaggctttgtggttgtctcagtcttcactggggccagtttagcaattcctctgaaaaaacatcctcttcttgagcttccacattaaaagttctaccctagagcagtgattttccatctggagcaaccgtgtccctcagtgcgggggagcttgggctatctctgaagaccgcgttcagttgctacagttagggtaaaggtgcggtggtgtctagtgggtaaggtttgggatgccatgaagcactccatgtacaaggcaagcacagtctgaggcggaactgccctggtctacagagacgcctttaatcccagcattggaggggcagatgctggaatccaaggccaacctgatctacacaatagggagttccaggacagccagggttacagaatgaaaccctgtttcaaaatacaaatcaaaacaacaataacagtaaagcccatcaaaataaaataaaccataacttatcaataaatgagctttgatggcagctttaacttcttccccccatgtggttctcagaattgttcgttaagaaaggcttctgtggagtgttttgttatggtatacacctgccatcctggagaggcggaggctggggattgtatgtttaaggacaggctaggctacactgtaagaccttgtttcctccaaacacaaagataaaaaagaagaaaggcaggaagagagtgtctgaaggagggagggagggagggaggagggggaagggaagggatgaagagagacaatgaggagaggaggagaagaggaaagagaaagaaggagcagagggaggcagcacagaagaacgcacaccatgaccaagggcctcttaggtctctctgttggtccaagatggaaatggagtttgaagtccttgtgcttttctggcgtcttgaggtttccccttggtctcccatgatccagctcgcagacttgcagcagacttaccctgcagcttctgtgtgatctgggctagccctgtgctcctgaggattgctgctgacaagcagggaagggccagtgggtcccactgactgttctcctggcacttgcaggagaacctgtctgagctccgccaggagaactacaggctcacattcaaccagcagctgacccgattttctgctcacgtagccgcttggctcgtctctactggagtgaccgcagcctgctgtgtagctgtctactacttggctgagtataactctgaggtaactctgcggaccagagcagagagagctggggaggactgggaggccactgggcagatgcagagcagatgcctccagcagggccctgtggccagcagcaactgcacccatagagaccttgcttcaaaatgcagaaccaagcctcttctcacggccagatctgcacttaggagcccccagggtgTAATGCACATCACAGGGCAAAGTGTACCAGGCTCCTGTGGACGTGGGACTTTGGCAGAGAGCTGG

This mutation is a 2287 bp deletion beginning at Chromosome 7 position 118,647,495 bp and ending after 118,649,781 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
53237 TGT CAC CCA TGA AAA AGC TG Wild type Forward A
53239 TGG TGG AGG AGG ACT TTG TG Wild type Reverse A
53240 ATG CCC CTA TAG TGT ATT AAG CA Mutant Forward A
53241 CAA AGT CCC ACG TCC ACA G Mutant Reverse A
53242 Fluorophore-1 CAC GGA GAT CAG GGT AAG TCC Quencher-1 WT Probe
53244 Fluorophore-2 ATG TAA TGC ACA TCA CAG GGC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
53237 0.40 uM
53239 0.40 uM
53240 0.40 uM
53241 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.