For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 035306
Protocol 38151: Probe Assay - Trim46<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:89243496-89243589 94bp CCCAAGGTGAGCCAGTTCT TAGAACCCCACATGCCAGTC
Mut = 101 bp
Wt = 94 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GGCGCAATGAAATTAATTCCACGTTTTAATTGATCAGATGTCACCCACCCCAGCCAGCTgtaattctcacctgtgcctcctgggtccatctacaggctttgggacataccctgggcggaagcgtggtgccttgcacccccagacgatcctattcccgtgcccagcctgccaaggcgatgtggagctgggggagaggggcctttccgggcttttccgaaacctgaccctagagcgagtggtggagaggtaccgccagagtgtgagtgtgggaggagccatcctgtgccagttgtgcaagcccccaccactagaggccaccaagggctgcacagagtgtcgagctaccttctgtaacgaatgcttcaagctcttccacccctggggcactcagaaggcgcagcatgagcccacgctacccactctttcattccgccccaaggtgagccagttcttgcgggggtctgaagtgggaggggctacagtggtgctgaaccAGAGGTTGGAGATGACTGGCATGTGGGGTTCTAAAGAGGGCTAGGTAAGGTTTTGTGTGTGTGTGTGTGTGTGTGTGTG
This mutation is a 435 bp deletion beginning at Chromosome 3 position 89,243,529 bp and ending after 89,243,963 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53135 | TAG AAC CCC ACA TGC CAG TC | Common | A | |||
| 53136 | CCC AAG GTG AGC CAG TTC T | Wild type Forward | A | |||
| 53137 | CTG ATC TCT GGC GCA ATG | Mutant Forward | A | |||
| 53138 | Fluorophore-1 | CTG AAG TGG GAG GGG CTA CA | Quencher-1 | WT Probe | ||
| 53139 | Fluorophore-2 | CCA CCC CAG CCA GCT AGA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 53135 | 0.40 uM |
| 53136 | 0.40 uM |
| 53137 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.