For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 035298
Protocol 38127: Probe Assay - Cfap58<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:47948047+47948192 146bp TGGGGACACTGGGAAAGAC GCAATTTCACCACTTCTGACA
Mut = 144 bp
Wt = 146 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CTTGTCTCTTAAGGCCTGAAGAGTGTGCACCACGGATCTCCCAGGAAGCCAGACTTGGGGACACTGGGAAAGACCCCCCAAAcaaatggccacttagtctgactcctgtgttctttctgttcagcatccgagatttactgaagttcaaagaagaggtgacgaaggagcgtgaccagctcttgtcagaagtggtgaaattgcgggagaacctagctcagaccatcgaaaagcagcaggcagcagagcacgccaaggaagaagctgaaatggccatcagtcaggtctgcccaccaccttccggttccggaggacggtctgtccttccggcctgctttcccctctagtgcctctctcagatgtaaaccgttatgtccaacccaagtgttctctgtactggctgtttctctggccgcgtctcatgagcccattttgCCCAGGGTTCTTTCTGTCCGAGAGGTCACTAAGGCAGTGTATGGCTCTGCTTAAGTTTTGGGTTCAGGTTCAGGTGGTGTCCCTGCAT
This mutation is a 350 bp deletion beginning at Chromosome 19 position 47,948,074 bp and ending after 47,948,423 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53076 | TGG GGA CAC TGG GAA AGA C | Common | A | |||
| 53077 | GCA ATT TCA CCA CTT CTG ACA | Wild type Reverse | A | |||
| 53078 | AGG CTG AGG GAT TTC TTG CT | Mutant Reverse | A | |||
| 53079 | Fluorophore-1 | CTG TTC AGC ATC CGA GAT TTA CTG | Quencher-1 | WT Probe | ||
| 53080 | Fluorophore-2 | CAA ACC CAG GGT TCT TTC TGT C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 53076 | 0.40 uM |
| 53077 | 0.40 uM |
| 53078 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.