For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 035292
Protocol 39523: Probe Assay - Cmtm7<em1(IMPC)J> Alternate 1
Version 2.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:114762219-114762380 162bp TGCTGTTGTTTGTTCCGTTC GGATTCTGGGAAAGCAAATG
Mut = 170 bp
Wt = 162 bp
Fam = Mut
Hex = Wt
Sequence
MUT Sequence (junction in uppercase):
ggaaatcctggcttagaggatatgaaatgtctacctctggcctccacacaagtacacacacatacatacatacataaacacacatgcatgcacacatacatatacatgtatacacacatacatacatgcacataCAcacacacacacccacacacacacaagcatttcttgaaataagcttcctgtgacaataataaaactcagaactcttacaaaaacgcaggcagtttttgtggtt
This mutation is a 5299 bp deletion beginning at Chromosome 9 position 114,758,536 bp and ending after 114,763,834 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51491 | GGG AAA TCC TGG CTT AGA GG | Mutant Forward | A | |||
| 53031 | AGA AAT GCT TGT GTG TGT GTG G | Mutant Reverse | A | |||
| 53034 | Fluorophore-1 | ATG TCT ACC TCT GGC CTC CAC A | Quencher-1 | MUT Probe | ||
| 54016 | TGC TGT TGT TTG TTC CGT TC | Wild type Forward | A | |||
| 54017 | GGA TTC TGG GAA AGC AAA TG | Wild type Reverse | A | |||
| 54018 | Fluorophore-2 | AGC TCT GCT CAT CCG AGA AGC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51491 | 0.40 uM |
| 53031 | 0.40 uM |
| 54016 | 0.40 uM |
| 54017 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.