For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr9:114789286-114789396 111bp CCTTCTAGCCTTTATTTTTCTTACAC CCACACACACGAAACAAATG
Mut = 82 bp
Wt = 111 bp
Fam = Mut
Hex = Wt
Common primer anneals over the nucleotide sequence containing mouse genomic variation rs248217201.
MUT Sequence (junction in uppercase):
gtttttattatgtatattggggatatgtctacatgggtgggcatgtgtgtataatatgtacaggtTGagattacatttgtttcgtgtgtgtggatgtgtgtttgtgcatgggtgcgggggcgccaatgtgcc
This mutation is a 6990 bp deletion beginning at Chromosome 9 position 114,789,313 bp and ending after 114,796,302 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
53026 | CCA CAC ACA CGA AAC AAA TG | Common | A | |||
53027 | CCT TCT AGC CTT TAT TTT TCT TAC AC | Wild type Forward | A | |||
53028 | GTA TAT TGG GGA TAT GTC TAC ATG G | Mutant Forward | A | |||
53029 | Fluorophore-1 | CGT GTG GAG TTT GTA AAG CCA | Quencher-1 | WT Probe | ||
53030 | Fluorophore-2 | TGG GCA TGT GTG TAT AAT ATG TAC AG | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
53026 | 0.40 uM |
53027 | 0.40 uM |
53028 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |