For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 035064
Protocol 37909: Probe Assay - Zfp267<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:36159344+36159484 141bp CATCTTTACTCAGGGGCTAGG AGTGACTCTGGTCTTAATGTGAGC
Mut= 170 bp
Wt= 141 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TTATGGGAAGTATACATGGTTTGAAAAGGACAAATGTCCTTCTCATCTGAAAGATAGCCATTTTGCATTAATATTCAATTGAAAAATATAAATACTTATGTTGATGCCTTTACATTTAGTATTTCGTAAAAGTATAGTATCTACTTCATCTTTACTCAGGGGCTAGGTAATACATTAGAAAATACCACTgtgttaaaatgtctcggtgaatagttaggattgctcagcttatgagaaactctttcttgactcacttcatcctggctcacattaagaccagagtcactgaccatatgaccattgtgctatgtatttttatttcaggaacagttgaccttcagggatgtggccattgatttttctggagaggaatgggagtgtctggattctgagcagcagaatttgtatacagatgtgatgttggaaaactataggaacctcgttttcctgggtaaggacaacctctccacaGAATTCCTAACTTGGTACTAAAATTCATTTTTCTTGTGTGATGGTTTGTATATGCTCGGCCCAGGAGTGGCACTATTAGAAAATGTGGCCCTGTTGGAGTAGGTGTGTCACTGTGGCTGTGGCCTATAAGACCCTCATCCTAGCTGCCTGGAAACCAGTATTCTGCTAGCACCCTTCAGATGAAGATGT
This mutation is a 282 bp deletion beginning at Chromosome 3 position 36,159,387 bp and ending after 36,159,668 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52482 | CAT CTT TAC TCA GGG GCT AGG | Common | A | |||
| 52483 | AGT GAC TCT GGT CTT AAT GTG AGC | Wild type Reverse | A | |||
| 52484 | ATA GGC CAC AGC CAC AGT GA | Mutant Reverse | A | |||
| 52485 | Fluorophore-1 | CGG TGA ATA GTT AGG ATT GCT CAG | Quencher-1 | WT Probe | ||
| 52486 | Fluorophore-2 | AAA TGT GGC CCT GTT GGA GTA GG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52482 | 0.40 uM |
| 52483 | 0.40 uM |
| 52484 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.