For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 034998
Protocol 37795: Probe Assay - Tmem177<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:119909518-119909636 119bp CCCTTTCTTTCTTGCAGTGG TCACAAGTCTCCTCACCTTGTC
Mut = 115 bp
Wt = 119 bp
Fam = Mut
Hex = Wt
Sequence
MUT Sequence (junction is in uppercase):
aaacccttgtagccactgagggacagctgtatacgcagtgctctcagaactgtgtctagcatacagtaggtgattaaacatgtgaatcctaagtcagttagagagtcactctaggatgaGCgaaatcttagtttccactcatagactttcccatgtgtttacatgctccctgctcccacagtcttagctaatttgcactctctctctctctctttctcctctc
This mutation is a 3508 bp deletion beginning at Chromosome 1 position 119,907,771 bp and ending after 119,911,278 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52175 | CCC TTT CTT TCT TGC AGT GG | Wild type Forward | A | |||
| 52176 | TCA CAA GTC TCC TCA CCT TGT C | Wild type Reverse | A | |||
| 52177 | TGC TCT CAG AAC TGT GTC TAG CAT | Mutant Forward | A | |||
| 52178 | TGG GAA AGT CTA TGA GTG GAA AC | Mutant Reverse | A | |||
| 52179 | Fluorophore-1 | CCT TGC CTT GAT CCT TGG A | Quencher-1 | WT Probe | ||
| 52180 | Fluorophore-2 | AGA GAG TCA CTC TAG GAT GAG CGA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52175 | 0.40 uM |
| 52176 | 0.40 uM |
| 52177 | 0.40 uM |
| 52178 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.