For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr3:95624861+95624963 103bp TGCCTGTCGCTCTAAAGAATC CCTCCTATGAGAGCCAATGAG
Mut = 99 bp
Wt = 103 bp
Fam = Mut
Hex = Wt
MUT Sequence (junction in uppercase):
tctctttcccggttggtgttctagcttgcctgtcgctctaaagaatccgcccacctccgGAGAAAGCAGGagggagcaggaatggtggacacagatgactggtggcctttgctggcttctgcctgtcctttatagctaattc
This mutation is a 7358 bp deletion beginning at Chromosome 3 position 95,624,895 bp and ending after 95,632,252 bp (GRCm38/mm10). There is a 9 bp AGAAAGCAG insertion at the deletion site.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
52157 | TGC CTG TCG CTC TAA AGA ATC | Common | A | |||
52158 | CCT CCT ATG AGA GCC AAT GAG | Wild type Reverse | A | |||
52159 | CAG GCA GAA GCC AGC AAA G | Mutant Reverse | A | |||
52160 | Fluorophore-1 | ATT GGT GTG TCG TTA CAT CAT TGC | Quencher-1 | WT Probe | ||
52161 | Fluorophore-2 | AGA AAG CAG GAG GGA GCA GG | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
52157 | 0.40 uM |
52158 | 0.40 uM |
52159 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |