For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 034976
Protocol 38279: End Point Analysis Assay - Ap4m1<em#Lutzy>
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = TG
Heterozygote = CA/TG
Wild type = CA
>chr5:138176867+138176937 71bp CTTCCGGCTCTTTCCCTCT TTCTAAAACACAGGAAATAGTCTCAC
Sequence
ATACCAGCTCTCTGATGACCTCCCCTCACCACTCCCCTTCCGGCTCTTTCCCTCTGTGCAGTGGGAC(c/t)(a/g)AGGCTCAGGCCGGTGAGACTATTTCCTGTGTTTTAGAACTACTCCATGCCATCCCGAGGCTTACAT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53447 | CTT CCG GCT CTT TCC CTC T | Forward | A | |||
| 53448 | TTC TAA AAC ACA GGA AAT AGT CTC AC | Reverse | A | |||
| 53449 | Fluorophore-1 | CAG TGG GAC CAA GGC TCA G | Quencher-1 | WT Probe | ||
| 53450 | Fluorophore-2 | AGT GGG ACT GAG GCT CAG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 53447 | 0.50 uM |
| 53448 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.