Protocol 37758: Probe Assay - Ssh2<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr11:77408144+77408235 92bp ACTTACCAAAACCGAACACG GAAAAATCCATTCCCAGGAC

Mut = 90 bp

Wt = 92 bp

Fam = Mut

Hex = Wt

 

Sequence

Wt Sequence (deletions in lower case):

ATTTAGGTCTCCCAACTTTTGACTCTCTTGCCTTGGTGGCATGCTATGAGATGctggcttaaaggggggaaaaaagggttaaatgatttaaaatttctctaatttttttgtttctttgttatctgttaacctcaggctgtaagactggaaagtacttaccaaaaccgaacacgctatatggtcgtggtttcaactaatggtagacaagacactgaagaaagcattgtcctgggaatggatttttcttctaatgacaggtatgataccataaaaaatggggaaggggcatgaaaactactttttaagagaactacttttaaaataacctgttacagttattaaagctattgcaaaagtgtcttgtataattaagcttttaaaattcaagataaagTAGGGCTAGAAGGTAAGAGGATGAGGTTTGTGCGTTTGTGTTTTATCTTTTTGAGACAAGATCTCTCTGATGTAGACCAGGCTGACCTTGAACTCAGAAATCAGCCC

This mutation is a 341 bp deletion beginning at Chromosome 11 position 77,408,044 bp and ending after 77,408,384 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
52082 ACT TAC CAA AAC CGA ACA CG Wild type Forward A
52083 GAA AAA TCC ATT CCC AGG AC Wild type Reverse A
52084 CCC AAC TTT TGA CTC TCT TGC Mutant Forward A
52085 GAT AAA ACA CAA ACG CAC AAA CCT C Mutant Reverse A
52086 Fluorophore-1 ATG GTC GTG GTT TCA ACT AAT GG Quencher-1 WT Probe
52087 Fluorophore-2 TGG TGG CAT GCT ATG AGA TGT AG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
52082 0.40 uM
52083 0.40 uM
52084 0.40 uM
52085 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.