For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:24077389+24077519 131bp GTTGCTGGGGTACCTATTATAACTC ATTTGCAGTTGATGAATGTCC
Mut = 169 bp
Wt = 131 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TTCATTTTTTATAATTAAAATACAAAAAGGATTTAtaaccgtgggttatatttaaaattaattcttcagtatggagttcatttctttaatttttatatctcaaaattactgttgtcttctagcaggacagaaatcccccaagcatcaaaaagcagattcatgaccagcaacttttcccaaccagccctgcagctctgctatgagaacacgaatggatcctgtattaaaactccctattctccagggccccgggtcatcctgtacatggtctatggctttggggctgtgctggcagtgtgtgggaacctcctggtggtgatttcagttctccatttcaagcagctgcactctccagccaattttctcatcgcctctctggccagtgctgacttcttggtgggcatctctgtgatgcccttcagcatggtcaggtccattgagagctgctggtactttggagatgcattttgtagccttcacagttgttgtgatgtggctttttgttactcttctgtcctccacctctgcttcatctcagtggacaggtacatcgctgtcacggaccctctggtctatcccaccaagttcacagtgtctgtgtctggaatttgcatcagcatctcctggattctgcccctggtgtacagcagtgcagtgttttacacaggcatcagtgctaaggggattgaaagcttagtaagtgctctaaattgtgtagggggctgccaaattgttatcaatcaagactttgttttgataagttttcttctattcttcatacctacccttgttatgatcattctttacagcaaaatatttttggtagccaaacagcaagctgtaaaaattgaaacttctgtaagtggcaacagaggtgaatcatcctcagagagtcacaaagccagagtggccaagagagagaggaaggctgcaaaaaccttgggggtcactgtggtggcttttatggtctcgtggctcccatacacaattgacgcattggttgatgctttcatgggcttcatcactcctgcctatgtctatgaaatctgttgctggggtacctattataactcagccatgaaccctttgatttatgctttcttttttccttggtttaagaaagccataaagcttattttaagtggggaaattctaaagggacattcatcaactgcaaatttattttcagagtaagcattaatacaaaattcagaaaattccttaaggtataaaattatgaaatggtgacagaactaaatctaataaatgaccttTATGAAGCTAGAAAAATACAGCATAAAAACATTAGTCAGGAGGA
This mutation is a 1239 bp deletion beginning at Chromosome 10 position 24,076,376 bp and ending after 24,077,614 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51999 | GTT GCT GGG GTA CCT ATT ATA ACT C | Wild type Forward | A | |||
| 52000 | ATT TGC AGT TGA TGA ATG TCC | Wild type Reverse | A | |||
| 52001 | CAG TGA CGT TTA ACA TAG TTA TAG GAA | Mutant Forward | A | |||
| 52002 | TTG ACA AGA CAT TCC TCC TGA | Mutant Reverse | A | |||
| 52003 | Fluorophore-1 | CCT TTG ATT TAT GCT TTC TTT TTT CC | Quencher-1 | WT Probe | ||
| 52004 | Fluorophore-2 | ATT GTG TGA CCA TCA ATG GGA AA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51999 | 0.40 uM |
| 52000 | 0.40 uM |
| 52001 | 0.40 uM |
| 52002 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.