Protocol 37652: Probe Assay - Brd3<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr2:27462409-27462503 95bp GATGCCTCAGGAGGAAGTTG GCCTTCTTTTACCTGCATTTTG

Mut = 100 bp

Wt = 95 bp

Fam = Mut

Hex = Wt

 

Sequence

Wt Sequence (deletions in lower case):

GCGTGTGCCACCACGCCTGGCGTAAAGACTGTTTTTATGCTTTGCATTCTTCTCAGATTTTCCACGTTGAAAAATAATCTTGTcctccctccatgacaaatctcttaacaaatatagtgctttcttgaactataacctacagtgttgttttttgcaagtgcacaactcctttcccagtgagtgacctgggttctctgtcttcagcccacagatgatatagtgctaatggcccaggccttagagaaaatctttctgcagaaagtggcccagatgcctcaggaggaagttgaactattgccccctgctccaaagggcaaaggccggaagccagctgcaggagcccaaaatgcaggtaaaagaaggcaggcagggagggagggagcacaggctttccctgctgaggctgtgggactcctttgatccctctaagtttttACTGTTGCCTGACAGGTAGGACAGGTGTCATGAGCTTGGCTGGTGATGGATCCTTAGCTG

This mutation is a 352 bp deletion beginning at Chromosome 2 position 27,462,338 bp and ending after 27,462,689 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
51878 GAT GCC TCA GGA GGA AGT TG Wild type Forward A
51879 GCC TTC TTT TAC CTG CAT TTT G Wild type Reverse A
51880 GCA TTC TTC TCA GAT TTT CCA C Mutant Forward A
51881 CAG CTA AGG ATC CAT CAC CA Mutant Reverse A
51882 Fluorophore-1 CCC CCT GCT CCA AAG G Quencher-1 WT Probe
51883 Fluorophore-2 CTT GTA CTG TTG CCT GAC AGG TAG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
51878 0.40 uM
51879 0.40 uM
51880 0.40 uM
51881 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.