For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 034804
Protocol 37513: Probe Assay - Urm1<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:29841378+29841477 100bp TTTGTTCTGTGCCTCCCTCT TCTCCCTGGATGAACAGCTC
Mut = 100 bp
Wt = 100 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GAACTGAGGTCTTTGACAGATCATCAGCCTCTCCTAATTAGGTTTCTGGGTCCATGTTTCTTTTGCActgggcacagttttggggcctaggaatgagttgggtttgacagtttgttctgtgcctccctctctaggggatatacggaacctccttgtctggatcaagaagaatttgctaaaagagcgaccagagctgttcatccagggagacagtgtgtgagttcccatcccccatccctgagcagggcagagggagggaaggctgtctgagtccacgtcCTGGGGTTCTGATTGTCTCATCCCCCTGAGTTCTCTGGCCCCATAGATTGA
This mutation is a 212 bp deletion beginning at Chromosome 2 position 29,841,335 bp and ending after 29,841,546 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51535 | TTT GTT CTG TGC CTC CCT CT | Wild type Forward | A | |||
| 51536 | TCT CCC TGG ATG AAC AGC TC | Wild type Reverse | A | |||
| 51537 | TGA CAG ATC ATC AGC CTC TCC | Mutant Forward | A | |||
| 51538 | CTA TGG GGC CAG AGA ACT CA | Mutant Reverse | A | |||
| 51539 | Fluorophore-1 | ACC TCC TTG TCT GGA TCA AGA AG | Quencher-1 | WT Probe | ||
| 51540 | Fluorophore-2 | TCC ATG TTT CTT TTG CAC TGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51535 | 0.40 uM |
| 51536 | 0.40 uM |
| 51537 | 0.40 uM |
| 51538 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.