For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 034724
Protocol 37424: Probe Assay - Cstad<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:30608167+30608267 101bp CTGCCTCCTCTGCTTCAGAC AACGTACATCCTCTGTGCTTCA
Mut = 97 bp
Wt = 101 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CATGACAGCAGCTGAGAACGCATCTCCCTGTCCCAGGTGGGGCCTGCCTCCTCTGCTTCAGACTTGCTTGGAGTTCGGAGCTCAGctgagccataacggaggctcacaaggaagagatcctgtgaagcacagaggatgtacgttaaggagttggggtgtggccagatatctgcctggggaattctgtactggaaggctctcccagctactcaggcaatcctgtgcctgtctccatggctttcaggagcatctcttgggtgacctggctcaccacatagtttcactgagagccatcatgagttggtacagccagTGGCCTGCCTTTCAAGTTCAAGGTCAGCCTTAGCGATGGAGAGAGAGAGTTCAAGACCAGCTGGACTACAGGGGAACTGTCTCAAAACAAACAAAAATGAGCTAAGAGGTTAGGAAGATGGCTCAGCAGATAAAAGCATTTG
This mutation is a 228 bp deletion beginning at Chromosome 2 position 30,608,209 bp and ending after 30,608,436 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51310 | CTG CCT CCT CTG CTT CAG AC | Common | A | |||
| 51311 | AAC GTA CAT CCT CTG TGC TTC A | Wild type Reverse | A | |||
| 51312 | CTT GAA CTC TCT CTC TCC ATC G | Mutant Reverse | A | |||
| 51313 | Fluorophore-1 | CCA TAA CGG AGG CTC ACA AG | Quencher-1 | WT Probe | ||
| 51314 | Fluorophore-2 | CAG TGG CCT GCC TTT CAA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51310 | 0.40 uM |
| 51311 | 0.40 uM |
| 51312 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.